Skip to main content

Table 1 Sequences of primers used for QRT-PCR

From: Tumor necrosis factor-inducible gene 6 promotes liver regeneration in mice with acute liver injury

Mouse
Gene Forward sequence Reverse sequence
g6pc TCCTCCTCAGCCTATGTCTGCATTC GAGAGAAGAATCCTGGGTCTCCTTG
tgf-β1 TTGCCCTCTACAACCAACACAA GGCTTGCGACCCACGTAGTA
α-sma AAACAGGAATACGACGAAG CAGGAATGATTTCCAAAGGA
collagen α1 GAGCGGAGAGTACTGGATCG GCTTCTTTTCCTTGGGGTTC
tnf-α TCGTAGCAAACCACCAAGTG ATATAGCAAATCGGCTGACG
il-1β ACTCCTTAGTCCTCGGCCA TGGTTTCTTGTGACCCTGAGC
cxcl1 CCCAAACCGAAGTCATAGCC TCAGAAGCCAGCGTTCACC
cxcl2 GCCCAGACAGAAGTCATAGCC TTCTCTTTGGTTCTTCCGTTGA
9 s GACTCCGGAACAAACGTGAGG CTTCATCTTGCCCTCGTCCA
Rat
Gene Forward Sequence Reverse Sequence
tsg-6 AGTGATGCGTCCGTCACAGCC AGATGGCTAAACCGTCCAGCTAAGA
9 s GACTCCGGAACAAACGTGAGGT CTTCATCTTGCCCTCGTCCA
Human
Gene Forward sequence Reverse sequence
tgf-β1 TTGACTGAGTTGCGATAATGTT GGGAAATTGCTCGACGAT
vimentin CGAAAACACCCTGCAATCTT GTGAGGTCAGGCTTGGAAAC
collagen α1 CAGATCACGTCATCGCACAA TGTGAGGCCACGCATGAG
9 s GACTCCGGAACAAACGTGAGGT CTTCATCTTGCCCTCGTCCA