Skip to main content

Advertisement

Table 1 Primers used for real-time quantitative PCR

From: Susceptibility of murine induced pluripotent stem cell-derived cardiomyocytes to hypoxia and nutrient deprivation

Gene Primer sequence (5′→3′) Annealing temperature (°C) Reference
Hif 1α Fw: CATGATGGCTCCCTTTTTCA 63 [55]
Rev: GTCACCTGGTTGCTGCAATA
Hif 2α Fw: GGGAACACTACACCCAGTGC 63 [55]
Rev: TCTTCAAGGGATTCTCCAAGG
Vegf Fw: ACTGGACCCTGGCTTTACTG 63 [56]
Rev: TCACTTCATGGGACTTCTGC
Glut-1 Fw: GCTTCCTGCTCATCAATCGT 63 [56]
Rev: CTTCTTCTCCCGCATCATCT
HSP70 Fw: TGGTGCTGACGAAGATGAAG 63 [57]
Rev: AGGTCGAAGATGAGCACGTT
PKCδ Fw: CAGACCAAGGACCACCTGTT 63 [58]
Rev: GCATAAAACGTAGCCCGGTA
PKCε Fw: GAGGACTGGATTGACCTGGA 63 [58]
Rev: ATCTCTGCAGTGGGAGCAGT
PKCθ Fw: ATGGACAACCCCTTCTACCC 63 [58]
Rev: GCGGATGTCTCCTCTCACTC
Bcl2 Fw: TGTGTGTGGAGAGCGTCAACA 65 [59]
Rev: TGCCGGTTCAGGTACTCAGTC
Bax Fw: GCGTGGTTGCCCTCTTCTACTTTG 65 [60]
Rev: AGTCCAGTGTCCAGCCCATGATG
Bad Fw: GGGAGCAACATTCATCAGCAGG 65 [60]
Rev: CATCCCTTCATCCTCCTCGGTC
Bcl-xL Fw: AACATCCCAGCTTCACATAACCCC 65 [60]
Rev: GCGACCCCAGTTTACTCCATCC
P53 Fw: ATTTGTATCCCGAGTATCTG 63 [56]
Rev: GGTATACTCAGAGCCGGCCT
Fas Fw: AGGACTGCAAAATGAATGGG 60 [61]
Rev: GGGTGCAGTTTGTTTCCACT
FADD Fw: GGGGACTCATCCTGTTTTCT 60 [62]
Rev: ATGCATAGTCTGGGGAGTCA
Gata4 Fw: AATGCCTGTGGCCTCTATCA 60 [63]
Rev: GGTCTCGCTCCTGGAAGATG
Mef2c Fw: ATTTGGGAACTGAGCTGTGC 60 [63]
Rev: CGCTCATCCATTATCCTCGT
Myh6 Fw: CCAACACCAACCTGTCCAAGT 60 [64]
Rev: AGAGGTTATTCCTCGTCGTGCAT
Nkx2.5 Fw: CCAGAACCGTCGCTACAAGT 60 [65]
Rev: GGGTAGGCGTTGTAGCCATA
Tnnt2 Fw: GCCAAAGATGCTGAAGAAGG 60 [66]
Rev: TTCTCGAAGTGAGCCTCGAT
Gapdh Fw: GGGGACTCATCCTGTTTTCT 60 [64]
Rev: ATGCATAGTCTGGGGAGTCA
  1. Fw, forward; Rev, reverse.