Skip to main content

Table 1 Reference genes and genes of interest for confirmational quantitative PCR

From: Influence of vascular endothelial growth factor stimulation and serum deprivation on gene activation patterns of human adipose tissue-derived stromal cells

Gene Accession no. Forward (sense) 5′→3′ Reverse (anti-sense) 5′→3′ Size, bp
SMOC2 NM_022138 TTAAGGAACCATTTGGAGGACAG CCACAAGCATCACAACATCAC 153
BMP6 NM_001718 CGTGAAGGCAATGCTCACCT CCTGTGGCGTGGTATGCTGT 135
IGF1 NM_001111285 ACCGACATGCCCAAGACCCA TTCAGCATTTCTACTTCCAATCTCCCT 185
MMP1 NM_001145938.1 GATGGACCTGGAGGAAATC GTCCAAGAGAATGGCCGA 403
MMP3 NM_002422 CTGTTGATTCTGCTGTTGAG AAGTCTCCATGTTCTCTAACTG 126
ITGB3 NM_000212 GGACACAGCCAACAACCCAC AGGAGGCATTCTGGGACAAAG 348
TBP NM_003194.4 TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA 339
YWHAZ NM_001135702.1 ACTTTTGGTACATTGTGGCTTCAA CCGCCAGGACAAACCAGTAT 245
  1. Regulated genes of interest selected for confirmational quantitative PCR including reference genes selected with consideration to donor- and treatment-variation. Table presents full name, NCBI accession number and forward and reverse primer sequences.