Skip to main content

Table 1 Primer sequences

From: Hypoxia-preconditioned mesenchymal stem cells attenuate bleomycin-induced pulmonary fibrosis

Gene Primer sequence
HO-1 Forward: AAGCCGAGAATGCTGAGTTCA
Reverse: GCCGTGTAGATATGGTACAAGGA
VEGFa Forward: CTGTGCAGGCTGCTGTAAC
Reverse: ACAGTGATTTTCTGGCTTTGTTC
BAX Forward: CGGCGAATTGGAGATGAACTG
Reverse: GCAAAGTAGAAGAGGGCAACC
Bcl-2 Forward: TACCGTCGTGACTTCGCAGAG
Reverse: CAGGCTGAGCAGGGTCTT
CAT Forward: CCTGACATGGTCTGGGACTT
Reverse: CAAGTTTTTGATGCCCTGGT
HGF Forward: GGCTGAAAAGATTGGATCAG
Reverse: TGGTTCTTGGTGTCATTGTTCCT
HIF-1α Forward: GGACGATGAACATCAAGTCAGCA
Reverse: GGAATGGGTTCACAAATCAGCAC
EPOR Forward: GGCTCCGAAGAACTTCTGTG
Reverse: CCAGGAGCACTACTTCATTG
Fibronectin Forward: CCCACCGTCTCAACATGCTTAG
Reverse:CTCGGCTTCCTCCATAACAAGTAC
Pro-IL-1β Forward: GCTCATCTGGGATCCTCTCC
Reverse: CCTGCCTGAAGCTCTTGTTG
IL-6 Forward: CCACTTCACAAGTCGGAGGCTTA
Reverse: GCAAGTGCATCATCGTTGTTCATAC
Col III Forward: GTTCTAGAGGATGGCTGTACTAAACACA
Reverse: TTGCCTTGCGTGTTTGATATTC
CTGF Forward: ACCTGGAGGAAAACATTAAGAAGG
Reverse: AGCCCTGTATGTCTTCACACTG
LacZ Forward: CCGTTGATGTTGAAGTGGC
Reverse: CTAATCCGAGCCAGTTTACCC
β-Actin Forward:GCGAGAAGATGACCCAGATC
Reverse:CCAGTGGTACGGCCAGAGG
GAPDH Forward: AGAGACGGCC GCATCTTCTT
Reverse: CCGTTCACACCGACCTTCAC
  1. BAX-2, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma 2; CAT, catalase; Col III, collagen type III; CTGF, connective tissue growth factor; EPOR, erythropoietin receptor; HGF, hepatocyte growth factor; HIF-1α, hypoxia-inducible factor 1α; HO-1, heme oxygenase-1; IL, interleukin; VEGF, vascular endothelial growth factor.