Skip to main content

Table 2 Complementarity analysis of tRNA species to 3′ untranslated regions of protein-coding genes

From: Human bone marrow- and adipose-mesenchymal stem cells secrete exosomes enriched in distinctive miRNA and tRNA species

Query Query sequence Hit length e value Bitscore Gene name Conservation value Normalized conservation value
tRNA; Glu; CTC AGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCC 14 0.19 28.2 GOLGA6A 0.510 0.970
tRNA; Glu; TTC TCCCTGGTGGTCTAGTGGCTAGGATTCGGCGCTTT 24 0.012 32.2 TFCP2L1 0.146 1.067
   14 0.19 28.2 NELF -0.303 0.962
   17 0.74 26.3 KIAA0513 -0.367 1.013
   13 0.74 26.3 ZBTB45 -0.447 0.950
   13 0.74 26.3 HHIPL1 -1.103 0.808
   13 0.74 26.3 HSP90AA1 -0.248 0.982
   13 0.74 26.3 TULP4 1.937 1.345
   13 0.74 26.3 SMAD3 0.259 1.001
   13 0.74 26.3 RPS19 -0.474 0.984
   13 0.74 26.3 ZNF662 0.140 0.990
   13 0.74 26.3 AC104841.2 2.810 1.542
tRNA; Gly; GCC GCATGGGTGGTTCAGTGGGAGAATTCTCGCCT 18 0.19 28.2 PHF13 0.042 0.914
   14 0.19 28.2 KDSR -0.243 0.904
   14 0.19 28.2 PLAGL2 0.634 0.881
   13 0.74 26.3 NOX5 -0.231 0.982
   13 0.74 26.3 EPM2AIP1 0.373 0.996
   13 0.74 26.3 GTF3C1 -0.476 1.095
   13 0.74 26.3 GPR110 0.293 1.053
   13 0.74 26.3 TPI1 0.241 0.971
   13 0.74 26.3 PPP2R1B -0.302 0.875
   13 0.74 26.3 LUZP2 0.125 0.998
   13 0.74 26.3 VPS41 -0.243 0.977
   13 0.74 26.3 SSR1 0.187 1.025
   13 0.74 26.3 RUNX2 1.358 0.956
   13 0.74 26.3 MAP1LC3B -0.254 0.890
  GCATGGGTGGTTCAGTGGTAGAATTCTCGCCG 14 0.19 28.2 GCM1 0.127 1.032
   17 0.74 26.3 SLC2A13 0.507 0.983
   13 0.74 26.3 GTF3C1 -0.476 1.095
   13 0.74 26.3 HHLA2 -0.075 1.004
   13 0.74 26.3 TPI1 0.241 0.971
   13 0.74 26.3 PEG10 -0.126 0.806
   13 0.74 26.3 EMR2 -0.166 0.954
   13 0.74 26.3 SSR1 0.187 1.025
   11 0.7 22.3 THAP5 0.155 0.979
   11 0.7 22.3 THAP5 0.393 1.029
  GCATGGGTGGTTCAGTGGTAGAATTCTCGCCTG 14 0.19 28.2 GCM1 0.127 1.032
   17 0.74 26.3 SLC2A13 0.507 0.983
   13 0.74 26.3 GTF3C1 -0.476 1.095
   13 0.74 26.3 HHLA2 -0.075 1.004
   13 0.74 26.3 TPI1 0.241 0.971
   13 0.74 26.3 PEG10 -0.126 0.806
   13 0.74 26.3 EMR2 -0.166 0.954
   13 0.74 26.3 SSR1 0.187 1.025
   11 0.73 22.3 THAP5 0.155 0.979
   11 0.73 22.3 THAP5 0.393 1.029
  GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGGGT 20 0.012 32.2 SOX11 0.180 0.752
   14 0.19 28.2 GCM1 0.127 1.032
   17 0.74 26.3 SLC2A13 0.507 0.983
   17 0.74 26.3 FAM57B -0.158 0.849
   13 0.74 26.3 HHLA2 -0.075 1.004
   13 0.74 26.3 C1orf159 -0.663 0.984
   13 0.74 26.3 KLC2 -0.224 0.835
   13 0.74 26.3 PEG10 -0.126 0.806
   13 0.74 26.3 DRG2 -0.468 0.817
   13 0.74 26.3 VPRBP 1.514 0.913
   13 0.74 26.3 TRIM62 -0.098 0.921
   13 0.74 26.3 EMR2 -0.166 0.954
   13 0.74 26.3 ANXA8L2 2.926 1.223