Skip to main content

Table 2 List of primers

From: Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity

Gene Primer sequences (5′–3′) Annealing temperature (°C) Amplicon (bp)
OCT4-F CCTCACTTCACTGCACTGTA 58 163
OCT4-R CAGGTTTTCTTTCCCTAGCT
KLF4-F GATGAACTGACCAGGCACTA 60 144
KLF4-R GTGGGTCATATCCACTGTCT
C-MYC-F TGCCTCAAATTGGACTTTGG 58 191
C-MYC-R GATTGAAATTCTGTGTAACTGC
SOX2-F CCCAGCAGACTTCACATGT 58 150
SOX2-R CCTCCCATTTCCCTCGTTTT
GDF3-F AAATGTTTGTGTTGCGGTCA 53 178
GDF3-R TCTGGCACAGGTGTCTTCAG
CRIPTO-F CGGAACTGTGAGCACGATGT 58 65
CRIPTO-R GGGCAGCCAGGTGTCATG
UTF1-F CCGTCGCTGAACACCGCCCTGCTG 58 179
UTF1-R CGCGCTGCCCAGAATGAAGCCCAC
DPPA4-F GGAGCCGCCTGCCCTGGAAAATTC 53 407
DPPA4-R TTTTTCCTGATATTCTATTCCCAT
DNMT3B-F TGCTGCTCACAGGGCCCGATACTTC 58 170
DNMT3B-R TCCTTTCGAGCTCAGTGCACCACAAAAC
LIN28-F AGTAAGCTGCACATGGAAGG 58 420
LIN28-R ATTGTGGCTCAATTCTGTGC
SALL4-F GCCGTGAAGACCAATGAGAT 58 243
SALL4-R CTCCTTCCACGCAAGTTCTC
RUNX2-F CAGTAGATGGACCTCGGGAA 60 188
RUNX2-R CCTAAATCACTGAGGCGGTC
ALP-F ATCAGGGACATTGACGTGATC 60 137
ALP-R TTCCAGGTGTCAACGAGGTC
COL1A1-F AGGGCCAAGACGAAGACATC 60 138
COL1A1-R AGATCACGTCATCGCACAAC
OC-F AGTCCAGCAAAGGTGCAGCC 60 169
OC-R TCAGCCAACTCGTCACAGTC
GAPDH-F TGGTATCGTGGAAGGACTCATGAC 53 189
GAPDH -R ATGCCAGTGAGCTTCCCGTTCAGC