Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers for quantitative RT-PCR and oligonucleotides

From: Roles of microRNA-34a targeting SIRT1 in mesenchymal stem cells

Name   Sequence
Quantitative RT-PCR   
 miR-34a Forward 5′-AAGGCCACGGATAGGTCCATA-3′
  Reverse 5′-CGCTTTGGTGGTTCTGAAAGG-3′
 SIRT1 Forward 5′-AAGGCCACGGATAGGTCCATA-3′
  Reverse 5′-CGCTTTGGTGGTTCTGAAAGG-3′
 FOXO3a Forward 5′-TGCCGATGGGTTGGATTT-3′
  Reverse 5′-CCAGTGAAGTTCCCCACGTT-3′
 U6 Forward 5′-AAGGCCACGGATAGGTCCATA-3′
  Reverse 5′-CGCTTTGGTGGTTCTGAAAGG-3′
 β-actin Forward 5′-CCCAGCACAATGAAGATCAAGATCAT-3′
  Reverse 5′-ATCTGCTGGAAGGTGTACAGCGA-3′
Oligonucleotide   
 miR-34a mimic   UGGCAGUGUCUUAGCUGGUUGUU CAACCAGCUAAGACACUGCCAUU
 NC mimic   UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
 miR-34a inhibitor   UGGCAGUGUCUUAGCUGGUUGUU
 NC inhibitor   CAGUACUUUUGUGUAGUACAA
 siRNA-SIRT1   GCACCGAUCCUCGAACAAUTT AUUGUUCGAGGAUCGGUGCTT
 siRNA-NT   UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
  1. FOXO3a forkhead box O transcription factor 3a, miRNA microRNA, NC negative control, siRNA small interfering RNA, siRNA-NT scrambled siRNA, SIRT1 silent information regulator 1