Skip to main content

Table 2 Primer sequences used for mRNA quantification

From: Endothelial properties of third-trimester amniotic fluid stem cells cultured in hypoxia

Gene NM_ Forward primer Reverse primer Amplicon, base pairs
ETV2 014209.2 AGTCGGACCGTGCCAGTTTG GAGCCACCTCTTTGGGGTCG 168
FLI1 002017.4 *GAGGAGCTTGGGGCAATAAC *AGAGCAGCTCCAGGAGGAAT 195
VEGF-A all isoforms TCACCATGCAGATTATGCGGA TGTTGTGCTGTAGGAAGCTCA 75
B2M 004048.2 CAACTTCAATGTCGGATGGATG GCTGTGCTCGCGCTACTCT 161
  1. *[28]