Skip to main content

Table 1 Primers for Sim1-Puro generation

From: A puromycin selectable cell line for the enrichment of mouse embryonic stem cell-derived V3 interneurons

Primer name Sequence
pstartK_Sim1_upstream AAAGTACTGTTTCTGGGGAAAACTCTAGTTTAGAGACCCTCCTGTTCTAAcgactgaattggttcctttaaagc
pstartK_Sim1_downstream GAACCAGGCAGAGGGAAAGCTTCTCATTAGTGCTTTTCCCTTCTCTCTCCgccgcactcgagatatctagaccca
Sim1_CAT_Forward GATGAGTCTGTGGAGTTTACGTTGTAAGAAGAAAGGGAGCCCGAGACACGGGCGCGCCagcattacacgtcttgagcgattgt
Sim1_CAT_Reverse 900 bp TTGAGGAAGGGTGAGCAAATGGGAGATCAAAGAGCTCCTTCCCTGGAGAGGGCGCGCCcacttaacggctgacatgggaatta
Sim1_Fwd_Junction1 atgcacacgactcttcaaagaa
Puro_Reverse Junction1 gcgccaggaggccttccatctgttgct
  1. Capital letters indicate homology arms for red recombination