Table 1 Quantitative polymerase chain reaction primers of osteogenic and angiogenic genes, with housekeeping gene β-Actin
Gene | Abbreviations | Forward 5'-3' | Reverse 3'-5’ |
|---|---|---|---|
Human β-Actin | Actin | ggcatcctcaccctgaagta | aggtgtggtgccagattttc |
Human alkaline phosphatase | ALP | ggaactcctgacccttgacc | tcctgttcagctcgtactgc |
Human type I collagen | Col1 | gagtgctgtcccgtctgc | tttcttggtcggtgggtg |
Human von Willebrand factor | vWF | gttcgtcctggaaggatcgg | cactgacacctgagtgagac |
Human VEGF165 | VEGF | tatgcggatcaaacctcacca | cacagggatttttcttgtcttgct |
Human Flt-1 (VEGF-R1) | Flt-1 | aaaggcacccagcacatcat | ttcccccctgcattgga |
Human KDR (VEGF-R2) | KDR | attcctcccccgcatca | gctcgttggcgcactctt |