Skip to main content

Table 3 Sequences of primers used in each step of screening for positive and negative selection steps during edited genome repair

From: RETRACTED ARTICLE: Robust method for TALEN-edited correction of pF508del in patient-specific induced pluripotent stem cells

CR4 Up TAG GTT GTA GCA GTG GTA GTG
CR4 Down CTC TAT GTA ACT CTT GTC TCT TCC
ZFN F TGG AGC CTT CAG AGG GTA AA
ZFN R TTT CAT GTG TTT GCA AGC TTC T
Integra5.1up TCC TCT GCT ACC TCC TTT CCT TCT
Integra5.2up TCT TCC TCT GCT ACC TCC TTT CCT
Integra5.3up TGC TTT TTC TTC CTC TGC TAC CTC C
Integra5.4up TTC CTC TGC TAC CTC CTT TCC TTC T
Integra5.5up TCC TCT GCT ACC TCC TTT CCT TC
Integra5.1dn GGA GCT CCA AGC GGC GAC TG
Integra5.2dn GCC TCA CGG GAG CTC CAA GC
Integra5.3dn TGA CAA GCA CGC CTC ACG GG
Integra5.4dn CTC ACG GGA GCT CCA AGC GG
Integra5.5dn ACC GCA TTG ACA AGC ACG CC
Integra3.1up ACA GAC CGA TAA AAC ACA TGC GTC A
Integra3.2up CAG ACC GATA AAA CAC ATG CGT CA
Integra3.3up AGA CCG ATA AAA CAC ATG CGT CA
Integra3.4up CAG ACC GAT AAA ACA CAT GCG TCA A
Integra3.5up AGA CCG ATA AAA CAC ATG CGT CAA
Integra3.1dn AGG CAC CTT CCG CAA CTT TTC CA
Integra3.2dn GGC ACC TTC CGC AAC TTT TCC A
Integra3.3dn AGG CAC CTT CCG CAA CTT TTC C
Integra3.4dn GGC ACC TTC CGC AAC TTT TCC AC
Integra3.5dn GGC ACC TTC CGC AAC TTT TCC
Reint F CTG CTG CAA CTT ACC TCC GGG ATG
Reint R CCA ATC CTC CCC CTT GCT GTC CTG
Recomb F TCT GTC ATC AAA GCC TGT CAG C
Recomb R GCTCGTTGACCTCCACTCAG
ENDO F GCGTCATCAAAGCATGCCAAC
PB-out-F GATCTGTCATCAAAGCCTGTCAG
PB-out-R CAGATCAATGCTCATTCCATTAGGC