Skip to main content

Table 1 The primer sequence of genes

From: The hepatocyte growth factor-expressing character is required for mesenchymal stem cells to protect the lung injured by lipopolysaccharide in vivo

Gene Primer Primer sequence PCR amplified products (bp)
GAPDH Forward primer 5’ > GTGCTGAGTATGTCGTGGAGTCT < 3’ 104
Reverse primer 5’ > GGAAGGGGCGGAGATGA < 3’
HGF Forward primer 5’ > GCACCTCCTCCTGCTTCC < 3’ 288
Reverse primer 5’ > CCAAACCCTTTTTTCACTCCA < 3’
  1. bp base pair, GAPDH glyceraldehyde-3-phosphate dehydrogenase, HGF hepatocyte growth factor, PCR polymerase chain reaction