Skip to main content

Advertisement

Table 1 Primer sequences for reverse transcription-PCR

From: Chm-1 gene-modified bone marrow mesenchymal stem cells maintain the chondrogenic phenotype of tissue-engineered cartilage

Gene Primers Product size (base pairs)
GAPDH TCACCATCTTCCAGGAGCGA 293
AGG CACAATGCCGAAGTGGTCGT GGTCGTGGTGAAAGGTGTTGT 315
Col II GCAGACGCATGAAGGCAAGTT AGCAGCAGCACGTGTGGTT 97
Chm-1 ATCTGGACGTTGGCAGTGTTG CCGCTCGAGCATGACCGAGAACTCGGACA 1022
  CCGGAATTCGCACCTGATACGCAAAGTGA