Skip to main content

Table 1 Custom-designed DNA primers used in real-time quantitative PCR study

From: Angiopoietin-1 receptor Tie2 distinguishes multipotent differentiation capability in bovine coccygeal nucleus pulposus cells

Gene Forward sequence Reverse sequence
18S ACGGACAGGATTGACAGATTG CCAGAGTCTCGTTCGTTATCG
TEK GGACAGGCAATAAGGATACG ACCGAGTGGATGAAGGAA
COL2 CGGGTGAACGTGGAGAGACA GTCCAGGGTTGCCATTGGAG
ACAN GGCATCGTGTTCCATTACAG ACTCGTCCTTGTCTCCATAG
HIF1α AGGTGGATATGTCTGGATA CAAGTCGTGCTGAATAATAC
  1. Amplicons were generated using a two-step amplification cycling (95 °C for 15 s and 57 °C for 30 s for 45 cycles) and SYBR-green mastermix
  2. TEK angiopoietin-1 receptor gene, COL2 collagen type II gene, ACAN aggrecan gene, HIF1α hypoxia-inducible factor 1 alpha gene, 18S ribosomal 18S RNA