Skip to main content

Table 1 Primers for quantitative PCR reactions

From: High-efficiency generation of induced pluripotent mesenchymal stem cells from human dermal fibroblasts using recombinant proteins

Gene name Forward primer Reverse primer
β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT
Klf4 CCCACATGAAGCGACTTCCC CAGGTCCAGGAGATCGTTGAA
Nanog TTTGTGGGCCTGAAGAAAACT AGGGCTGTCCTGAATAAGCAG
c-Myc GGCTCCTGGCAAAAGGTCA CTGCGTAGTTGTGCTGATGT
Sox2 GCCGAGTGGAAACTTTTGTCG GGCAGCGTGTACTTATCCTTCT
Oct4 CTGGGTTGATCCTCGGACCT CCATCGGAGTTGCTCTCCA
ABCG2 CAGGTGGAGGCAAATCTTCGT ACCCTGTTAATCCGTTCGTTTT
hTERT TAATGGGCTCCTTTCACCTG CAGTGCGTCTTGAGGAGCA
Insulin GCAGCCTTTGTGAACCAACAC CCCCGCACACTAGGTAGAGA
Pdx1 ATCTCCCCATACGAAGTGCC CGTGAGCTTTGGTGGATTTCAT
Nkx6.1 GGACTGCCACGCTTTAGCA TGGGTCTCGTGTGTTTTCTCT
C/EBPα CTTCAGCCCGTACCTGGAG GGAGAGGAAGTCGTGGTGC
PPARγ GGGATCAGCTCCGTGGATCT TGCACTTTGGTACTCTTGAAGTT