Skip to main content

Table 2 Primers for RT-PCR reactions

From: High-efficiency generation of induced pluripotent mesenchymal stem cells from human dermal fibroblasts using recombinant proteins

Gene name Forward primer Reverse primer
β-actin AGAGCTACGAGCTGCCTGAC AGCACTGTGTTGGCGTACAG
PPARγ TTCAGCAGCGTGTTCGACTT AGGAATCGCTTTCTGGGTCA
C/EBPα CTAACTCCCCCATGGAGTCGG GTCGATGGACGTCTCGTGC
CollagenI GATGGATTCCAGTTCGAGTATG GTTTGGGTTGCTTGTCTG TTTG
CbfaI GATGACACTGCCACCTCTGA GACTGGCGGGGTGTAAGT
Osteocalcin ATGAGAGCCCTCACACTCCTC CGTAGAAGCGCCGATAGGC
Osterix TAATGGGCTCCTTTCACCTG CACTGGGCAGACAGTCAGAA
Bone Sialo protein TCAGCATTTTGGGAATGGCC GAGGTTGTTGTCTTCGAGGT
Osteonectin AGTAGGGCCTGGATCTTCTT CTGCTTCTCAGTCAGAAGG
Nestin AGCTGGCGCACCTCAAGATG AGGGAAGTTGGGCTCAGGAC
GFAP GAGGCGGCCAGTTATCAGGA GTTCTCCTCGCCCTCTAGCA