Skip to main content

Table 1 Forward (F) and reverse (R) primer pairs used for polymerase chain reactions to detect hepatic specific gene transcripts in human adipose-derived stem cells, induced heaptocytes, and primary human hepatocytes

From: Rapid generation of functional hepatocyte-like cells from human adipose-derived stem cells

Primer Sequence (5′–3′)
AAT F: TGAGTTCGCCTTCAGCCTATACC
R: AGTCCTCTTCCTCGGTGTCCTT
ALB F: GGTGAGACCAGAGGTTGATGTG
R: GCAGCAGCACGACAGAGTAATC
AFP F: GCAGCCAAAGTGAAGAGGGAAGAC
R: GCAGACAATCCAGCACATCTCCTC
HNF4α F: GGTGTCCATACGCATCCTTG
R: TGTCCGTTGCTGAGGTGAG
TDO2 F: CCGTAGAAGGCAGCGAAGAAG
R: GCTCCCTGAAGTGCTCTGTATG
CYP3A4 F: ATGGTCAACAGCCTGTGCT
R: CATGCTGTAGGCCCCAAAGA
TTR F: GGCATCTCCCCATTCCATGA
R: TTCCTTGGGATTGGTGACGAC
CK18 F: ATGAGCTTCACCACTCGCTC
R: TGGCAATCTGGGCTTGTAGG
CK19 F: GCTTTGTGTCCTCGTCCTCC
R: TTGGCTTCGCATGTCACTCA
CK7 F: CCCAGACATCTTTGAGGCCC
R: TTCACGGCTCCCACTCCATC
human ALU F: AATATGGCCCAACTGCAGAA
R: CATCGCATTTTCACATCCAA
β-actin F: GGCATCGTGATGGACTCCG
R: GCTGGAAGGTGGACAGCGA