Skip to main content

Table 2 Forward (F) and reverse (R) primer pairs used for polymerase chain reactions to detect hepatic specific gene transcripts in human adipose-derived stem cells, induced heaptocytes, and primary human hepatocytes

From: Rapid generation of functional hepatocyte-like cells from human adipose-derived stem cells

Primer Sequence (5′–3′)
β-actin F: TGGACTTCGAGCAAGAGATG
R: GAAGGAAGGCTGGAAGAGTG
CYP1A2 F: CTTCGCTACCTGCCTAACCC
R: GACTGTGTCAAATCCTGCTCC
CYP1A1 F: CAAGGGGCGTTGTGTCTTTG
R: GTCGATAGCACCATCAGGGG
CYP2A6 F: CAGCACTTCCTGAATGAG
R: AGGTGACTGGGAGGACTTGAGGC
CYP2B6 F: GCACTCCTCACAGGACTCTTG
R: CCCAGGTGTACCGTGAAGAC
CYP2C9 F: CTACAGATAGGTATTAAGGACA
R: GCTTCATATCCATGCAGCACCAC
CYP2D6 F: TGAAGGATGAGGCCGTCTGGGAGA
R: CAGTGGGCACCGAGAAGCTGAAGT
CYP3A4 F: TTCAGCAAGAAGAACAAGGACAA
R: GGTTGAAGAAGTCCTCCTAAGC