Skip to main content

Table 1 Primer sequences for real-time quantitative PCR

From: Regulatory roles of interferon-inducible protein 204 on differentiation and vasculogenic activity of endothelial progenitor cells

Gene name Forward primer Reverse primer
GAPDH ACATCATCCCTGCATCCACT CACATTGGGGGTAGGAACAC
CD31 TGGCCAGTCACTTGAAGACA CAGTTGTTGTAGCCAGCCATT
VE-cadherin TACTCAGCCCTGCTCTGGTT GCTTGCAGAGGCTGTGTCTT
vWF ACGCCATCTCCAGATTCAAG AAGCATCTCCCACAGCATTC
VEGF AGCACAGCAGATGTGAATGC AATGCTTTCTCCGCTCTGAA