Skip to main content

Table 1 Gene-specific primers used for quantitative RT-PCR

From: Significant improvement of direct reprogramming efficacy of fibroblasts into progenitor endothelial cells by ETV2 and hypoxia

Gene Forward primer Reverse primer
EFNB2 TCCTCAACTGTGCCAAACCAGACCAA AGGCCCTCCAAAGACCCATTTGATGT
EPHB4 AAGAAAGTTTCGCAGCCGCTGGCTTT TCATGTGCTGGACACTGGCCAAGATT
HEY1 AAATGCTGCATACGGCAGGAGGGAAA ATAACGCGCAACTTCTGCCAGGCAT
JAG1 TTTGGAGCGACCTGTGTGGATGAGA TGGTGATGCAAGGTCTCCCTGAAACT
NR2F2 GGACCACATACGGATCTTCCAAGAGCAA TTTCCTGCAAGCTTTCCACATGGGCT
NRP2 AGGAGCCCTGTGGTTGGATGTATGA TGTCACTCTGCAGCCGCAAGAAAT
PROX1 ACCCGTTATCCCAGCTCCAATATGCT ATCGTTGATGGCTTGACGTGCGTA
SOX18 TGAACGCCTTCATGGTGTGGGCAAA CGCGTTCAGCTCCTTCCACGCTTT