Skip to main content

Table 1 Primers used in the study

From: Expression of neural cell adhesion molecule and polysialic acid in human bone marrow-derived mesenchymal stromal cells

Primer UniGene Forward (5′➔3′) Reverse (5′➔3′) Amplicon size (base pairs)
GAPDH Hs.544577 GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC 225
NCAM-All Hs.503878 GGACTTCTACCCGGAACATCAG CGAGCTTAGGTGCACTGGG  
 NCAM-140 (Variant 1), NCAM-125 (Variant 4)     798
 NCAM-180 (Variant 2)     828
 NCAM-120 (Variant 3)     903
 NCAM Variant 5     906
NCAM-180 NM_181351.4 GCTTCGTGGACTCGACCAG GCAGATGTACTCTCCGGCATC 126
NCAM-140 NM_000615.6 CGAAGAAAAGACTCTGGATGG TCATGCTTTGCTCTCGTTCT 1498
NCAM-125/140 NM_001242608.1 / NM_000615.6 CGAAGAAAAGACTCTGGATGG GTTCCCCTTGGACTGGC 755
NCAM-125 NM_001242608.1 CAGCCAGTCCAAGGGG TGTAGGATGCAGAATTGCCTC 346
NCAM120/125 NM_001076682.3 / NM_001242608.1 GAGTATGAGGTCTACGTGGTGGC GCAGAGAAAAGCAATGAGACAAAG 152
NCAM-120 NM_001076682.3 TCTGCTAGCTCGTCTACCCC CCAAAGGGGGCACTGATCTT 541
NCAM Variant 5 NM_001242607.1 GCTTCGTGGACTCGACCAG GCAGATGTACTCTCCGGCATC 204
ST8SIA2 Hs.302341 GGGCAACTCGGGGGTCTTGC AAGGCCCGCTGGATGACCGA 162
ST8SIA4 Hs.308628 ACAGGCGCCGGACACTAAACA TGCAGCAAACTCCACCACAGGA 200