Skip to main content

Advertisement

Table 1 Forward and reverse primer sequences used for reverse transcriptase PCR

From: Exendin-4 enhances the differentiation of Wharton’s jelly mesenchymal stem cells into insulin-producing cells through activation of various β-cell markers

Gene Forward primer Reverse primer
GAPDH GCCAAAAGGGTCATCATCTC TGAGTCCTTCCACGATACCA
Pdx-1 GGAGCCGGAGGAGAACAAG CTCGGTCAAGTTCAACATGACAG
Nkx2.2 TCTACGACAGCAGCGACAAC TTGTCATTGTCCGGTGACTC
Isl-1 ATTTCCCTATGTGTTGGTTGCG CGTTCTTGCTGAAGCCGATG
MafA TTCAGCAAGGAGGAGGTCAT CGCCAGCTTCTCGTATTTCT