Skip to main content

Table 1 Primer sequences and product lengths

From: Establishing a tree shrew model of systemic lupus erythematosus and cell transplantation treatment

Gene Primer sequence Product length (base pairs) Annealing temperature (°C)
IL-17 TATGAGGAGCAAATGGGTCA 117 60
CAGCAAAGTAACATCCAGCCTA
Foxp3 CACTCAAGGAGGCGTTGTC 175 60
GGTGGCATAGGTGAAAGGAG
GAPDH GTTTGTGATGGGCGTGAAC 171 60
GTCTTCTGGGTGGCAGTGA