Skip to main content

Table 1 Primer sequences

From: Repair of human periodontal bone defects by autologous grafting stem cells derived from inflammatory dental pulp tissues

  Gene Gene bank accession number Primer sequence (5′–3′) Product (base pair)
Reference GAPDH NM_002046.3 Forward: GCACCGTCAAGGCTGAGAAC 138
Reverse: TGGTGAAGACGCCAGTGGA
Osteogenesis ALP NM_000478.4 Forward: CATGCTGAGTGACACAGACAAGAA 141
Reverse: ACAGCAGACTGCGCCTGGTA
OCN NM_199173.4 Forward: ATGAGAGCCCTCAGACTCCTC 297
Reverse: CGGGCCGTAGAAGCGCCGATA
Adipogenesis LPL NM_000237.2 Forward: GTCACGGGCTCAGGAGCATTA 144
Reverse: GCTCCAAGGCTGTATCCCAAGA
PPARγ-2 NM_015869.4 Forward: TGGAATTAGATGACAGCGACTTGG 182
Reverse: CTGGAGCAGCTTGGCAAACA
Chondrogenesis ACAN NM_001135.3 Forward: ACGAAGACGGCTTCCACCAG 134
Reverse: TCGGATGCCATACGTCCTCA
COL2A1 NM_001844.4 Forward: CCAGTTGGGAGTAATGCAAGGA 123
Reverse: ACACCAGGTTCACCAGGTTCA