Skip to main content

Advertisement

Table 2 Primers of fibroblast phenotypic hallmark genes for quantitative real-time PCR

From: Preclinical study of mouse pluripotent parthenogenetic embryonic stem cell derivatives for the construction of tissue-engineered skin equivalent

Gene Primers (5′–3′) Product (bp)
Col-I TCTCCCCCAAGACACAGGAA 103
GCTGGGTAGGGAAGTAGACG
Col-III ACTGTCCCACGTAAGCACTG 106
CAGGAGGGCCATAGCTGAAC
Tn-c CCTACTGTCACGCGTCTCTC 112
AAGCCACAACGAGTTCCCAA
Mmp1 GAGCCACAGATGAGCACAGA 103
AATCTGAACGCTCGCAGTGA
vimentin CGCTCCTACGATTCACAGCC 189
TGTGGACGTGGTCACATAGC
Fsp1 CTTCCTGTCCTGCATTGCCA 112
GGCAAACTACACCCCAACAC