Skip to main content

Advertisement

Table 1 Oligonucleotide sequences used for reverse transcription polymerase chain reaction analysis

From: Microvesicles secreted from equine amniotic-derived cells and their potential role in reducing inflammation in endometrial cells in an in-vitro model

Reference sequence Markers Forward Reverse Annealing temperature bp
XM_001498494.3 Progesteron Receptor (PR) GTCAGTGGACAGATGCTGTA CGCCTTGATGAGCTCTCTAA 55 °C 255
NM_001256979.1 Membrane-associated progesterone receptor (MPR) GCCAAGTATCGTTACCGGAG AAGAGGATCTGGAGCGTGTG 55 °C 173
XM_001914705.2 Progester one receptor membrane component 1 (PGRMC1) TCAACGGCAAGGTGTTCGAC GGCTCTTCCTCATCTGAGTA 58 °C 280
XM_003364827.1 Homeobox protein Hox-A9-like (Hoxa9) ACGCTGGAACTGGAGAAAGA CTTTCGCTCGGTCCTTATTG 55 °C 160
NM_001163856.1 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) AGATCAAGAAGGTGGTGAAG TTGTCATACCAGGAAATGAGC 59 °C 178
NM_001081847.2 Matrix metallopeptidase 1 (MMP-1) ACTGCCAAATGGACTTCAAGCTGC TCTTCACAGTGCTAGGAAAGCCG 60 °C 158
NM_001081804.1 Matrix metallopeptidase 13 (MMP-13) CTCTGGTCTGCTGGCTCACGC CCAAACTCGTGTGCAGCGAC 60 °C 132