Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Human genes used in quantitative real-time PCR

From: Oxidative status predicts quality in human mesenchymal stem cells

Gene Primer nucleotide sequence (5′ → 3′) Amplicon (bp)
Housekeeping gene
 GAPDH F - TGGACTCCACGACGTACTCA 102
R - GGAAGCTTGTCATCAATGGAA
Mitochondrial biogenesis
 POLG F - GCTGGTGGAAGAGCGTTACTC 241
R - GAAGCTGCTTAGCCCTGAGAT
 POLG2 F - GGTTTGGGGGTCGAGTAGATG 186
R - TTCCACTTAGGAAATGCCTTCTC
 NRF1 F - AACAAAATTGGGCCACGTTACA 291
R - TCTGGACCAGGCCATTAGCA
 TFAM F - ATGGCGTTTCTCCGAAGCAT 133
R - CAGATGAAAACCACCTCGGTAA
 PGC-1α F - GCTTTCTGGGTGGACTCAAGT 142
R - TCTAGTGTCTCTGTGAGGACTG
 PGC-1β F - CCACATCCTACCCAACATCAAG 93
R - CACAAGGCCGTTGACTTTTAGA
Mitochondrial chaperones
 PHB F - CACAGAAGCGGTGGAAGC 96
R - ATGGCCGCCTITTTCTGT
 PHB2 F - TGCTGAACCTACAGGATGAAA 77
R - TGGTGACTAGGCTCATITCTTACC
 MRP5S F - GAAATCGATCCGTGTCTTGG 87
R - GCATCCATCCGATCAGTAGC
Telomere length
 Telomere teloF - CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT >76
teloR - GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT
 36B4 F - CAGCAAGTGGGAAGGTGTAATCC 75
R - CCCATTCTATCATCAACGGGTACAA
mtDNA copy number
 ND1 F - GGAGTAATCCAGGTCGGT 265
R - TGGGTACAATGAGGAGTAGG
 CF F - AGCAGAGTACCTGAAACAGGAA 482
R - AGCTTACCCATAGAGGAAACATAA
  1. bp base pair, F Forward, mtDNA mitochondrial DNA, R Reverse