Skip to main content

Table 1 Primers used for qRT-PCR analysis

From: Exosomes derived from human menstrual blood-derived stem cells alleviate fulminant hepatic failure

Primer name Sequence (5’-3’) Species
GAPDH-F AATGGATTTGGACGCATTGGT Mouse
GAPDH-R TTTGCACTGGTACGTGTTGAT
IL-6-F GGCGGATCGGATGTTGTGAT Mouse
IL-6-R GGACCCCAGACAATCGGTTG
IL-1β-F GTACATCAGCACCTCACAAG Mouse
IL-1β-R CACAGGCTCTCTTTGAACAG
TNF-α-F ACTCCCAGAAAAGCAAGCAA Mouse
TNF-α-R CGAGCAGGAATGAGAAGAGG
Caspase-3-F TACCGGTGGAGGCTGACT Mouse
Caspase-3-R GCTGCAAAGGGACTGGAT