Skip to main content

Advertisement

Table 1 Primer list- Real Time PCR

From: Development of a surrogate potency assay to determine the angiogenic activity of Stempeucel®, a pooled, ex-vivo expanded, allogeneic human bone marrow mesenchymal stromal cell product

Markers Forward primer Reverse primer Tm Product length
β-Actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT 60 250bp
VEGF-A GCAGAATCATCACGAAGTGG GCATGGTGATGTTGGACTCC 60 234bp
TGF-β1 CAGATCCTGTCCAAGCTG TCGGAGCTCTGATGGTGTT 56 270bp
Ang-1 GCTTACCAGATTCACACTGTTCC TTGCTACCTTGCCAACAACAACTG 60 612bp
IL-6 CACAGACAGCCACTCACCTC TTTTCTGCCAGTGCCTCTTT 60 137bp
HGF ATGCATCCAAGGTCAAGGAG TTCCATGTTCTTGTCCCACA 61 349bp
SDF-1α/CXCL12 TGCCAGAGCCAACGTCAAG CAGCCGGGCTACAATCTGAA 60 73bp
VEGFR1 CGTAGAGATGTACAGTGAAA GGTGTGCTTATTTGGACATC 55 306bp
VEGFR2 TTACAGATCTCCATTTATTGC TTCATCTCACTCCCAGACT 60 498bp
VEGFR3 CTGGACCGAGTTTGTGGAGG GTCACATAGAAGTAGATGAGCCG 60 138bp
  1. Tm melting temperature, VEGF-A vascular endothelial growth factor A, TGF-β transforming growth factor beta, Ang-1 angiopoietin-1, IL interleukin, HGF hepatocyte growth factor, SDF-1 stromal-derived factor-1, VEGFR1 vascular endothelial growth factor receptor 1, VEGFR2 vascular endothelial growth factor receptor 2, VEGFR3 vascular endothelial growth factor receptor 3