Skip to main content

Table 1 Primers used for RT-PCR to detect CTLA-4, Nanog mRNAs

From: CD117+CD44+ Stem T Cells Develop in the Thymus and Potently Suppress T-cell Proliferation by Modulating the CTLA-4 Pathway

β-actin sense GAA ATC GTG CGT GAC ATC AAA G
 Antisense TGT AGT TTC ATG GAT GCC ACA G
CTLA-4 sense TCTGCAAGGTGGAACTCA
 Antisense GCTAACTG CGACAAGGAT
Nanog sense ATCCCGAGAACTATTCTTG
 Antisense GGTACTTCTGCTTCTGAAAC