Skip to main content

Table 1 Primers sequences for gene expression analysis using real-time PCR

From: Compared to the amniotic membrane, Wharton’s jelly may be a more suitable source of mesenchymal stem cells for cardiovascular tissue engineering and clinical regeneration

Genes Accession number Primer sequence (5′-3′) Product size (bp)
Collagen-I NM_000088.3 Forward: AAGGTGTTGTGCGATGACG
Reverse: TGGTCGGTGGGTGACTCTG
116
Collagen-IV NM_001303110.1 Forward: AGGAGACTTCGCCACCAA
Reverse: GGTCCTGTGCCTATAACAATT
264
Vimentin NM_003380.3 Forward: CTGAACCTGAGGGAAACTAA
Reverse: AGAAAGGCACTTGAAAGCT
231
Connexin-43 NM_000165.4 Forward: CAGTCTGCCTTTCGTTGT
Reverse: CTCTTCCTTTCGCATCAC
168
Vitronectin NM_000638.3 Forward: CAAAGGCTACCGTTCACAA
Reverse: AGACACTCTGGATGGGTTCA
182
Elastin NM_001278918.1 Forward: CGCTGGTGCTCTTATCTTC
Reverse: GCTTCAGGTGCTTGGGTA
176
β-Actin NM_005559.3 Forward: AGCGAGCATCCCCCAAAGTT
Reverse: GGGCACGAAGGCTCATCATT
285