Skip to main content

Table 1 List of primers used in real time polymerase chain reaction

From: Effect of cryopreservation on proliferation and differentiation of periodontal ligament stem cell sheets

Primer ID Sequence (5′–3′)
RUNX2-F GTTTCACCTTGACCATAACCGT
RUNX2-R GGGACACCTACTCTCATACTGG
OSX-F ACCTACCCATCTGACTTTGCTC
OSX-R CCACTATTTCCCACTGCCTTG
OCN-F AATCCGGACTGTGACGAGTTG
OCN-R CAGCAGAGCGACACCCTAGAC
PPARγ2-F CTCCTATTGACCCAGAAAGC
PPARγ2-R GTAGAGCTGAGTCTTCTCAG
LPL-F ATGGAGAGCAAAGCCCTGCTC
LPL-R GTTAGGTCCAGCTGGATCGAG
GAPDH-F TGGGCAAGATTAAGATCGGAAT
GAPDH-R TTGATGTCGCTGTGCTTCCA
  1. GAPDH glyceraldehyde 3-phosphate dehydrogenase, F forward, LPL lipoprotein lipase, OCN osteocalcin, OSX osterix, PPARγ2 peroxisome proliferating activated receptor γ, R reverse, RUNX2 runt-related transcription factor 2