Skip to main content

Table 1 Primer sequences

From: The crosstalk between vascular MSCs and inflammatory mediators determines the pro-calcific remodelling of human atherosclerotic aneurysm

Gene Primer sequence
α-SMA FWD: ACCTTTGGCTTGGCTTGTCA
REV: GGAAGCTTTAGGGTCGCTGG
BMP-2 FWD: TGTCTTCTAGCGTTGCTGCT
REV: CAACTCGAACTCGCTCAGGA
CD31 FWD: CACAGATGAGAACCACGCCT
REV: GGCCCCTCAGAAGACAACAT
CD146 FWD: CTCACTCGGACGTCAGACAC
REV: AACACAGTGGGCGCTATGAA
GAPDH FWD: AATGGGCAGCCGTTAGGAAA
REV: AGGAGAAATCGGGCCAGCTA
IL-1β FWD: TGAGCTCGCCAGTGAAATGA
REV: AGATTCGTAGCTGGATGCCG
IL-10 FWD: GGGGCTTCCTAACTGCTACA
REV: TAGGGGAATCCCTCCGAGAC
MMP-9 FWD: GAACCAATCTCACCGACAG
REV: GCCACCCGAGTGTAACCAT
PPAR-γ FWD: GTGGTAGGTAAGGAAGGGGC
REV: GGCTGACTCTCGTTTGAGAA
OPN FWD: AGGCATCACCTGTGCCATAC
REV: GTCCAAGCTTCTGGGGACAA
OCN FWD: CACCGAGACACCATGAGAGC
REV: CTGCTTGGACACAAAGGCTGC
TNF-α FWD: CAGGGACCTCTCTCTAATCA
REV: TTGAGGGTTTGCTACAACAT
  1. α-SMA alpha-smooth muscle actin, BMP-2 bone morphogenetic protein-2, CD cluster of differentiation, GAPDH glyceraldehyde 3-phosphate dehydrogenase, IL interleukin, MMP-9 matrix metalloproteinase-9, PPAR-γ peroxisome proliferation activated gamma, OPN osteopontin, OCN osteocalcin, TNF-α tumour necrosis factor alpha