Skip to main content

Advertisement

Table 1 Primers used for reverse-transcription polymerase chain reaction

From: Effects of mechanical stimulation on the reprogramming of somatic cells into human-induced pluripotent stem cells

Target Primer Sequence (5′ to 3′)
Total OCT4 F GAGAAGGATGTGGTCCGAGTGTG
Total OCT4 R CAGAGGAAAGGACACTGGTCCC
Total SOX2 F AGAACCCCAAGATGCACAAC
Total SOX2 R ATGTAGGTCTGCGAGCTGGT
Total KLF4 F ACCCTGGGTCTTGAGGAAGT
Total KLF4 R ACGATCGTCTTCCCCTCTTT
Total c-MYC F CCTACCCTCTCAACGACAGC
Total c-MYC R CTCTGACCTTTTGCCAGGAG
Endo-OCT4 F GACAGGGGGAGGGGAGGAGCTAGG
Endo-OCT4 R CTTCCCTCCAACCAGTTGCCCCAAAC
Endo-SOX2 F GGGAAATGGGAGGGGTGCAAAAGAGG
Endo-SOX2 R TTGCGTGAGTGTGGATGGGATTGGTG
Endo-KLF4 F ACGATCGTGGCCCCGGAAAAGGACC
Endo-KLF4 R TGATTGTAGTGCTTTCTGGCTGGGCTCC
Endo-c-MYC F GCGTCCTGGGAAGGGAGATCCGGAGC
Endo-c-MYC4 R TTGAGGGGCATCGTCGCGGGAGGCTG
hTERT F CGGAAGAGTGTCTGGAGCAA
hTERT R GGATGAAGCGGAGTCTGGA
TDGF F TCCTTCTACGGACGGAACTG
TDGF R AGAAATGCCTGAGGAAAGCA
Nanog F CAAAGGCAAACAACCCACTT
Nanog R ATTGTTCCAGGTCTGGTTGC
pMXs-AS3200 R TTATCGTCGACCACTGTGCTGCTG
pMXs-L3205 R CCCTTTTTCTGGAGACTAAATAAA
Exo-hOCT4 F CCCCAGGGCCCCATTTTGGTACC
Exo-hSOX2 F GGCACCCCTGGCATGGCTCTTGGCTC
Exo-hKLF4 F ACGATCGTGGCCCCGGAAAAGGACC
Exo-c-MYC F CAACAACCGAAAATGCACCAGCCCCAG
hSOX17 F CGC TTT CAT GGT GTG GGC TAA GGA CG
hSOX17 R TAG TTG GGG TGG TCC TGC ATG TGC TG
hAFP F GAA TGC TGC AAA CTG ACC ACG CTG GAA C
hAFP R TGG CAT TCA AGA GGG TTT TCA GTC TGG A
hCK8 F CCT GGA AGG GCT GAC CGA CGA GAT CAA
hCK8 R CTT CCC AGC CAG GCT CTG CAG CTC C
hCK18 F AGC TCA ACG GGA TCC TGC TGC ACC TTG
hCK18 R CAC TAT CCG GCG GGT GGT GGT CTT TTG
hMAP2 F CAG GTG GCG GAC GTG TGA AAA TTG AGA GTG
hMAP2 R CAC GCT GGA TCT GCC TGG GGA CTG TG
hPAX6 F ACC CAT TAT CCA GAT GTG TTT GCC CGA G
hPAX6 R ATG GTG AAG CTG GGC ATA GGC GGC AG
  1. F forward, R reverse