Skip to main content

Advertisement

Table 1 Primer sequences for quantitative real-time PCR

From: Curcumin induces therapeutic angiogenesis in a diabetic mouse hindlimb ischemia model via modulating the function of endothelial progenitor cells

Gene name Forward primer (5′–3′) Reverse primer (5′–3′)
mVEGF-A AGCACAGCAGATGTGAATGC AATGCTTTCTCCGCTCTGAA
mANG-1 ATCTTGATAACCGCAGCCAC TGTCGGCACATACCTCTTGT
GAPDH TGTGTCCGTCGTGGATCTGA ACCACCTTCTTGATGTCATCATACTT