Skip to main content

Advertisement

Table 1 Primer sequences

From: Exosomes secreted by stem cells from human exfoliated deciduous teeth contribute to functional recovery after traumatic brain injury by shifting microglia M1/M2 polarization in rats

  Gene Gene bank accession Primer sequence (5′—3′) forward primer reverse primer Product (bp)
Reference β-actin NM_007393 GCCCTGAGGCTCTTTTCCAG 51
TGCCACAGGATTCCATACCC
M1 phenotype CD11b NM_001082960.1 GAGCAGCACTGAGATCCTGTTTAA 64
ATACGACTCCTGCCCTGGAA
CD86 NM_019388.3 ACGATGGACCCCAGATGCACCA 88
GCGTCTCCACGGAAACAGCA
CD16 XM_006496658.2 TGTGTGTCGTCGTAGACGGT 396
TTCGCACATCAGTGTCACCA
MHCII NM_010382.2 ACAGGAATTGTGTCCACGGG 472
AAGGCCTGGGTCAGGGATAA
iNOS NM_010927.3 GACGAGACGGATAGGCAGAG 80
GTGGGGTTGTTGCTGAACTT
M2 phenotype CD206 NM_000237.2 TCAGCTATTGGACGCGAGGCA 105
TCCGGGTTGCAAGTTGCCGT
IL-10 NM_010548.2 CGGCTGAGGCGCTGT 51
TGCCTTGCTCTTATTTTCACAGG
Arg-1 NM_007482.3 AGCCAATGAAGAGCTGGCTGGT 91
AACTGCCAGACTGTGGTCTCCA