Skip to main content

Table 1 Primer sequences

From: Exosomes secreted by stem cells from human exfoliated deciduous teeth contribute to functional recovery after traumatic brain injury by shifting microglia M1/M2 polarization in rats

  Gene Gene bank accession Primer sequence (5′—3′) forward primer reverse primer Product (bp)
Reference β-actin NM_007393 GCCCTGAGGCTCTTTTCCAG 51
M1 phenotype CD11b NM_001082960.1 GAGCAGCACTGAGATCCTGTTTAA 64
M2 phenotype CD206 NM_000237.2 TCAGCTATTGGACGCGAGGCA 105