Skip to main content

Table 1 Primers used for real-time PCR

From: Connexin 32 and connexin 43 are involved in lineage restriction of hepatic progenitor cells to hepatocytes

Rat-Cx43-S TCTGCCTTTCGCTGTAACACT
Rat-Cx43-AS GGGCACAGACACGAATATGAT
Rat-CX32-S CCAGGGCTCAAGGTTATTGA
Rat-CX32-AS TCTCCATCCACAGTGCAGAG
Rat-Afp-S ACCTGACAGGGAAGATGGTG
Rat-Afp-AS GCAGTGGTTGATACCGGAGT
Rat-Alb-S AATTGGCAACAGACCTCACC
Rat-Alb-AS GCACTGGCTTATCACAGCAA
Rat-CYP1B1-S CCCGTGGTGGTGCTGAAT
Rat-CYP1B1-AS AAAGAGGCGAAGGGAGGC
Rat-CK18-S TTTGCGAATTCTGTGGACAA
Rat-CK18-AS ACCTCGTGATGTTGGTGTCA
Rat-CK19-S CCACACTACGCAGATCCAGA
Rat-CK19-AS ATGCTGAGCTGAGACTGCAA
Rat-Hnf1a-S ACCAGTCCCACAGTGTCCTC
Rat-Hnf1a-AS GCCATCTGGGTGGAGATAAA
Rat-Hnf4a-S AAATGTGCAGGTGTTGACCA
Rat-Hnf4a-AS CACGCTCCTCCTGAAGAATC
Rat-Ggt4-S GTCACCAACTTCAACTCTGC
Rat- Ggt4-AS CCTTATCACTGTTTACCTCGG
Rat-Hnf6-S GAAAATAAGCGTCCGTCCAAAG
Rat-Hnf6-AS CTGGCATTCATGAAGAAGTTGC
Rat-GAPDH-S TGCCACTCAGAAGACTGTGG
Rat-GAPDH-AS TTCAGCTCTGGGATGACCTT
  1. S sense, AS anti-sense