Skip to main content

Advertisement

Table 1 Primers designed for real-time PCR and the respective amplicon sizes of the products

From: Isolation and prolonged expansion of oral mesenchymal stem cells under clinical-grade, GMP-compliant conditions differentially affects “stemness” properties

Gene symbol Type of marker Forward (5′–3′) Reverse (5′–3′) Amplicon size (bp)
BMP-2 Osteogenic GGAACGGACATTCGGTCCTT AGTCCGTCTAAGAAGCACGC 100
ALP Osteogenic CCGTGGCAACTCTATCTTTGG CAGGCCCATTGCCATACAG 89
RUNX2 Osteogenic CCACCGAGACCAACAGAGTC TCACTGTGCTGAAGAGGCTG 118
BGLAP Osteogenic GACTGTGACGAGTTGGCTGA AAGAGGAAAGAAGGGTGCCT 137
ACAN Chondrogenic CACCTCCCCAACAGATGCTT GGTACTTGTTCCAGCCCTCC 107
SOX9 Chondrogenic AGGAAGTCGGTGAAGAACGG CGCCTTGAAGATGGCGTTG 84
PPAR-γ Adipogenic GACAACCTGCTACAAGCCCT TTGGCAAACAGCTGTGAGGA 71
LPL Adipogenic CGAGCGCTCCATTCATCTCT CCAGATTGTTGCAGCGGTTC 137
B2M Housekeeping TGTCTTTCAGCAAGGACTGGT ACATGTCTCGATCCCACTTAAC 138
SDHA Housekeeping GCATGCCAGGGAAGACTACA GCCAACGTCCACATAGGACA 127