Skip to main content

Table 3 Human gene primer sequences

From: Laser-modified titanium surfaces enhance the osteogenic differentiation of human mesenchymal stem cells

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
GAPDH AGGTGCGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
RUNX2 TCAACGATCTGAAGATTTGTGGG GGGGAGGATTTGTGAAGACGG
BMP2 TTCGGCCTGAAACAGAGACC CCTGAGTGCCTGCGATACAG
ALPL ACTGGTACTCAGACAACGAGAT ACGTCAATGTCCCTGATGTTATG
OCN GGCGCTACCTGTATCAATGG GTGGTCAGCCAACTGGTCA
OPN GAAGTTTCGCAGACCTGACAT GTATGCACCATTCAACTCCTCG
  1. GAPDH glyceraldehyde-3-phosphate dehydrogenase, RUNX2 runt-related transcription factor 2, BMP2 bone morphogenetic protein 2, ALPL alkaline phosphatase, OCN osteocalcin, OPN osteopontin