Skip to main content

Advertisement

Table 1 Primers used for RT-PCR and qRT-PCR analysis

From: Two sides of the same coin? Unraveling subtle differences between human embryonic and induced pluripotent stem cells by Raman spectroscopy

Gene Forward primer Reverse primer
GAPDH TCCTCTGACTTCAACAGCGA GGGTCTTACTCCTTGGAGGC
CCNA2 CAGCCAGACATCACTAACAGT CCCACAAGCTGAAGTTTTCCT
CCNB1 GTTGGTGTCACTGCCATGTT TGGCCAAAGTATGTTGCTCG
CCND1 GTCTGCGAGGAACAGAAGTG GGATGGAGTTGTCGGTGTAG
CCNE1 GGAAGAGGAAGGCAAACGTG GCAATAATCCGAGGCTTGCA
OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAAC
c-MYC AGAAATGTCCTGAGCAATCACC AAGGTTGTGAGGTTGCATTTGA
REX1 ACCAGCACACTAGGCAAACC TTCTGTTCACACAGGCTCCA
KLF4 ATAGCCTAAATGATGGTGCTTGG AACTTTGGCTTCCTTGTTTGG
NANOG TGCAAGAACTCTCCAACATCCT ATTGCTATTCTTCGGCCAGTT
SeV* GGATCACTAGGTGATATCGAGC ACCAGACAAGAGTTTAAGAGATATGTATC
KOS-tg* ATGCACCGCTACGACGTGAGCGC ACCTTGACAATCCTGATGTGG
Klf4-tg* TTCCTGCATGCCAGAGGAGCCC AATGTATCGAAGGTGCTCAA
cMYC-tg* TAACTGACTAGCAGGCTTGTCG TCC ACATACAGTCCTGGATGATGATG
SOX7 TGAACGCCTTCATGGTTTG AGCGCCTTCCACGACTTT
HAND1 CCAGCTACATCGCCTACCTG CCGGTGCGTCCTTTAATCCT
ACTA2 GTGATCACCATCGGAAATGAA TCATGATGCTGTTGTAGGTGGT
MYL2 TACGTTCGGGAAATGCTGAC TTCTCCGTGGGTGATGATG
NESTIN CAGCGTTGGAACAGAGGTTGG TGGCACAGGTGTCTCAAGGGTAG
BMP4 CCTGTTGTGTGCCCACTGAAC ATCTCAGCGGCACCCACAT
  1. *Used for SeV genome and transgene detection in cells reprogrammed using CytoTune 2.0 Sendai vectors (Thermo Scientific)
  2. qRT-PCR quantitative reverse transcription PCR, RT-PCR reverse transcription PCR