Skip to main content

Table 1 List of primers for polymerase chain reaction

From: Promoting the expansion and function of human corneal endothelial cells with an orbital adipose-derived stem cell-conditioned medium

Gene Primer Sequence (5′–3′) Size (bp)
Na+/K+ ATPase α 1 Forward CTGTGGATTGGAGCGATTCTT 112
Reverse TTACAACGGCTGATAGCACCA
Zo-1 Forward ATCCCTATCACCCAGCGTCA 152
Reverse TCTCCCACTCTGTCTCCAGG
Col8a2 Forward CGACCTGAAAGCACGTCCAC 85
Reverse AGAGGCATTTCAGTAGCAGCA
SLC4A4 Forward TGATCGGGAGGCTTCTTCTCT 154
Reverse GGACCGAAGGTTGGATTTCTTG
GAPDH Forward GCACCGTCAAGGCTGAGAAC 138
Reverse TGGTGAAGACGCCAGTGGA