Skip to main content

Table 1 Primers used for quantitative reverse transcriptase polymerase chain reaction

From: Targeted reversion of induced pluripotent stem cells from patients with human cleidocranial dysplasia improves bone regeneration in a rat calvarial bone defect model

Gene symbol GenBank accession no. Forward primer sequence Reverse primer sequence
RUNX2 NM_001024630.2 gtgcctaggcgcatttca gctcttcttactgagagtggaagg
ALP NM_000478.3 caaccctggggaggagac gcattggtgttgtacgtcttg
COL1A1 NM_000088.3 gggattccctggacctaaag gggattccctggacctaaag
OSX NM_152860.1 catctgcctggctccttg caggggactggagccata
OC NM_199173.3 tgagagccctcacactcctc acctttgctggactctgcac
MSX2 NM_002449.4 tcggaaaattcagaagatgga caggtggtagggctcatatgtc
DLX5 NM_005221.5 ctacaaccgcgtcccaag gccattcaccattctcacct
DLX3 NM_005220.2 gagcctcctaccggcaatac tcctccttcaccgacactg
TWIST1 NM_000474.3 agctacgccttctcggtct ccttctctggaaacaatgacatc
18SrRNA M11188.1 cggacaggattgacagattg cgctccaccaactaagaacg