Skip to main content

Table 2 Primers used for real-time quantitative PCR

From: Comprehensive characterization of chorionic villi-derived mesenchymal stromal cells from human placenta

  Forward sequence (5′–3′) Reverse sequence (5′–3′)
GAPDH GAAGGTGAAGGTCGGAGTCA AATGAAGGGGTCATTGATGG
SOX2 GAGAGTGTTTGCAAAAGGGG TGGGGCTCAAACTTCTTCTC
SOX2 (2) CCACCTACAGCATGTCCTACTCG GGGAGGAAGAGGTAACCACAGG
OCT4 GCAGAAGAGGATCACCCTGG AAAGCGGCAGATGGTCGTTT
OCT4 (2) CTGCACAGATATGCAAAGCAG TGATCTGCTGCAGTGTGGGT
NANOG CTTGCCTTGCTTTGAAGCAT TTCTTGACCGGGACCTTGTC
NANOG (2) ACCTCAGCTACAAACAGGT AAAGGCTGGGGTAGGTAGGT
hTERT CGGAAGAGTGTCTGGAGCAA GGATGAAGCGGAGTCTGGA
hTERT splicing variant GCC TGA GCT GTA CTT TGT CAA CGC AAA CAG CTT GTTCTC CAT GTC
ERK1/2 (MAPK1) GCTAGATTCCAGCCAGGATACA AGAACACCGATGTCTGAGCA
AKT1 ATGAGCGACGTGGCTATTGT CCTCACGTTGGTCCACATCC
CSHL1 CTGTGGACAGCTCACCTAGC AGCCTGGATAAGGGAACGGT
SMAD2 GTGGCAGGCGGGTCTAC GCAAGCCACGCTAGGAAAAC
SMAD8 GTGGCCAACCTGTAGATGCC CTCCCCAACTCGGTTGTTCA
β-Catenin GGAGGAAGGTCTGAGGAGCAG ATTGTCCACGCTGGATTTTCAA
SMAD1/5/9 CAGAGTGGCCAACCTGTAGA TCCCCAACTCGGTTGTTCAG
  1. GAPDH glyceraldehyde 3-phosphate dehydrogenase, SOX2 sex determining region Y-box 2, OCT4 octamer-binding transcription factor 4, hTERT human telomerase reverse transcriptase, ERK extracellular signal-regulated kinase 2, also known as mitogen-activated protein kinase 1 (MAPK1), AKT protein kinase B, CSHL chorionic somatomammotropin hormone like 1, SMAD, mothers against decapentaplegic homolog