Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences and amplification conditions for RT-PCR analysis

From: Establishment of xenogeneic serum-free culture methods for handling human dental pulp stem cells using clinically oriented in-vitro and in-vivo conditions

Gene Primer sequences, 5′–3′ Product size (bp) Annealing temp. (°C) PCR cycles GenBank accession number
Vimentin S: GGGACCTCTACGAGGAGGAG 200 55 35 NM_003380
A: CGCATTGTCAACATCCTGTC     
Runx2 S: CCCCACGACAACCGCACCAT 292 55 35 NM_004348
A: GTCCACTCCGGCCCACAAATC     
Collagen I S: CCAAATCTGTCTCCCCAGAA 214 55 35 NM_000088
A: TCAAAAACGAAGGGGAGATG     
Nestin S: AACAGCGACGGAGGTCTCTA 220 55 35 NM_006617
A: TTCTCTTGTCCCGCAGACTT     
Nanog S: ACCTTCCAATGTGGAGCAAC 199 55 35 NM_024865
A: GAATTTGGCTGGAACTGCAT     
Oct3/4 S: GACAGGGGGAGGGGAGGAGCTAGG 144 60 35 NM_001173531
A: CTTCCCTCCAACCAGTTGCCCCAAAC     
Sox2 S: AACCCCAAGATGCACAACTC 152 60 40 NM_003106
A: CGGGGCCGGTATTTATAATC     
OCN S: GCTGAGTCCTGAGCAGCAG 323 60 30 NM_199173
A: CGATAGGCCTCCTGAAAGC     
DSPP S: CATTTGGGCAGTAGCATGGG 170 55 35 NM_014208
A: CACCTTCATGCACCAGGACA     
PPARγ S: TCGGATCCCTCCTCGGAAAT 399 60 35 AB565476
A: GCAGGCTCCACTTTGATTGC     
FABP4 S: TGGGCCAGGAATTTGACGAA 212 60 35 NM_001442
A: ACGTCCCTTGGCTTATGCTC     
Bcl-2 S: GGTGAACTGGGGGAGGATTG 214 60 35 NM_000633
A: GAAATCAAACAGAGGCCGCA     
Bax S: AAGAAGCTGAGCGAGTGTCTC 338 60 35 NM_001291428
A: AGTCGCTTCAGTGACTCGG     
p53 S: TACCAGGGCAGCTACGGTTT 572 55 25 AB082923
A: CCTTTCTTGCGGAGATTCTCT     
p21 S: TCAGAACCGGCTGGGGATGT 554 60 35 NM_001291549
A: AGATGTAGAGCGGGCCTTTG     
p16 S: CCCAACGCACCGAATAGT 135 65 35 XM_011517676
A: CACGGGTCGGGTGAGAGT     
β-actin S: GGACTTCGAGCAAGAGATGG 234 60 30 NM_001101
A: AGCACTGTGTTGGCGTACAG     
  1. RT-PCR reverse transcription polymerase chain reaction, S sense, A antisense, Runx2 runt-related transcription factor 2, Oct3/4 POU class 5 homeobox 1 (POU5F1), SOX2 sex determining region Y-box 2, OCN osteocalcin, DSPP dentin sialophosphoprotein, PPARγ peroxisome proliferator-activated receptor gamma, FABP4 fatty acid binding protein 4, Bcl-2 B-cell lymphoma 2, BAX B-cell lymphoma-2 associated X