Skip to main content

Table 1 Primer sequences

From: Therapeutic effect of human umbilical cord-derived mesenchymal stem cells on injured rat endometrium during its chronic phase

Gene name Primer sequence
rat-α-SMA-qPCR-F CCTCTTCCAGCCATCTTTCAT
rat-α-SMA-qPCR-R CGAGAGGACGTTGTTAGCATAG
rat-TGF-β1-qPCR-F AGAGCCCTGGATACCAACTA
rat-TGF-β1-qPCR-R CAACCCAGGTCCTTCCTAAAG
rat-Ki-67-qPCR-F CTGCAGAGAAGGTTGGGATAAA
rat-Ki-67-qPCR-R CTGACTTTGCCCAGAGATGAA
rat-VEGFA-qPCR-F GAAGACACAGTGGTGGAAGAAG
rat-VEGFA-qPCR-R ACAAGGTCCTCCTGAGCTATAC
rat-MMP9-qPCR-F GCTGCTCCAACTGCTGTATAA
rat-MMP9-qPCR-R TGGTGTCCTCCGATGTAAGA
rat-CD31-qPCR-F GCCGTCAAATACTGGGTTAGT
rat-CD31-qPCR-R GCACTGTACACCTCCAAAGAT
rat-IFN-γ-qPCR-F GTGAACAACCCACAGATCCA
rat-IFN-γ-qPCR-R GAATCAGCACCGACTCCTTT
rat-TNF-α-qPCR-F CCCAATCTGTGTCCTTCTAACT
rat-TNF-α-qPCR-R CAGCGTCTCGTGTGTTTCT
rat-IL-2-qPCR-F GCAGGCCACAGAATTGAAAC
rat-IL-2-qPCR-R CCAGCGTCTTCCAAGTGAA
rat-IL4-qPCR-F GGTGAACTGAGGAAACTCTGTAG
rat-IL4-qPCR-R TCCAGGAAGTCTTTCAGTGTTG
rat-IL-10-qPCR-F AGTGGAGCAGGTGAAGAATG
rat-IL-10-qPCR-R GAGTGTCACGTAGGCTTCTATG
rat-GAPDH-qPCR-F GCAAGGATACTGAGAGCAAGAG
rat-GAPDH-qPCR-R GGATGGAATTGTGAGGGAGATG