Skip to main content

Table 1 Sequence information of primers used for quantitative real-time polymerase chain reaction

From: Bone regeneration by human dental pulp stem cells using a helioxanthin derivative and cell-sheet technology

Gene Primer sequences (forward and reverse, 5′–3′)
GAPDH GAAGGTGAAGGTCGGAGTCA
GAAGATGGTGATGGGATTTC
Runx2 CAGACCAGCAGCACTCCATA
CAGCGTCAACACCATCATTC
Alp ATGAAGGAAAAGCCAAGCAG
ATGGAGACATTCTCTCGTTC
ColIa1 GTGCTAAAGGTGCCAATGGT
CTCCTCGCTTTCCTTCCTCT
Osteocalcin GGCAGCGAGGTAGTGAAGAG
AGCAGAGCGACACCCTAGAC