Skip to main content

Advertisement

Table 1 Primer sequences used for quantitative polymerase chain reaction analysis

From: Amenable epigenetic traits of dental pulp stem cells underlie high capability of xeno-free episomal reprogramming

Gene Forward 5’ to 3’ Reverse 5’ to 3’
GAPDH CAAGGTCATCCATGACAACTTTG GGCCATCCACAGTCTTCTGG
ACTA CTCGGAGATCATCACGTTTG CCTTGGAAATCTCGAAGTGC
LIN28 GAAGCGCAGATCAAAAGGAG GCTGATGCTCTGGCAGAAGT
OCT4 GCAAAACCCGGAGGAGTC CCACATCGGCCTGTGTATATC
SOX2 TTGCTGCCTCTTTAAGACTAGGA CTGGGGCTCAAACTTCTCTC
NANOG CCAACATCCTGAACCTCAGC GCTATTCTTCGGCCAGTTG
DPPA2 TGGTGTCAACAACTCGGTTTG CTCGAACATCGCTGTAATCTGG
TGFb1 GCAGCACGTGGAGCTGTA CAGCCGGTTGCTGAGGTA
PDGFRA AGGTGGTTGACCTTCAATGG TTTGATTTCTTCCAGCATTGTG
FN1 CTGGCCGAAAATACATTGTAAA CCACAGTCGGGTCAGGAG
hERVFRD TGAGGAGGGCAATCCATTTCAT TGCATGGTCGTTAAGGCTT
hPAX9 GTTATGTTGCTGGACATGGGT GAAGCCGTGACAGAATGACTAC