Skip to main content

Advertisement

Table 2 SYBR green primers used for PCR analyses

From: Inflammatory licensed equine MSCs are chondroprotective and exhibit enhanced immunomodulation in an inflammatory environment

Gene Abbreviation Function Forward 5′–3’ Reverse 5′–3’
Secretory carrier membrane protein 3 SCAMP3 Housekeeping gene CTGTGCTGGGAATTGTGATG ATTCTTGCTGGGCCTTCTG
Major histocompatibility complex class I MHC-I Self-recognition ACCGTGAGGTCACCCTGA CTCCGTGTCCTGGGTCA
Major histocompatibility complex class II MHC-II Antigen presentation TCCCTATGCTGGGACTTTTC CGCCAGGCTTCAGATAGAAC
Indoleamine 2,3-dioxygenase IDO Mediator of immunomodulation TCATGACTACGTGGACCCAAAA CGCCTTCATAGAGCAGACCTTC
Prostaglandin endoperoxide synthase 2 PTGS2 Mediator of immunomodulation CAGCATAAACTGCGCCTTTTC AGGCGGGTAGATCATTTCCA
Inducible nitric oxide synthase NOS2 Mediator of immunomodulation CCAACAATGGCAACATCAGGT TGAGCATTCCAGATCCGGA
Interleukin-6 IL-6 Cytokine TGCTGGCTAAGCTGCATTCA GGAAATCCTCAAGGCTTCGAA
Interleukin-8 IL-8 Cytokine GCTGGCTGTTGCTCTCTTG CCGAAGCTCTGCAGTAATTCTT
Interleukin-10 IL-10 Cytokine GCCTTGTCGGAGATGATCCA TTTTCCCCCAGGGAGTTCAC
Tumor necrosis factor alpha TNF-α Cytokine AAAGGACATCATGAGCACTGAAAG GGGCCCCCTGCCTTCT
Interferon gamma IFN-γ Cytokine CCAGCGCAAAGCAATAAGTG GGCCTCGAAACGGATTCTG
C-C motif chemokine 2 CCL2 Chemokine GGCTCAGCCAGATGCAATTA GCTTTCTTGTCCAGCTGCTT
C-X-C motif chemokine 10 CXCL10 Chemokine GACTCTGAGTGGAACTCAAGGAAT GTGGCAATGATCTCAACACG
Collagen type 2 COL2A1 Cartilage extracellular matrix TCAAGTCCCTCAACAACCAGATC GTCAATCCAGTAGTCTCCGCTCTT