Skip to main content

Table 1 Primer sequences used for gene expression analysis

From: Intramuscular transplantation of bone marrow cells prolongs the lifespan of SOD1G93A mice and modulates expression of prognosis biomarkers of the disease

Gene 5′ → 3′ Primer sequence
NT4 Forward TGAGCTGGCAGTATGCGAC
Reverse CAGCGCGTCTCGAAGAAGT
NGF Forward GCACTACACCCATCAAGTTCA
Reverse TCCTGAGTCATGCTCACAAGT
BDNF Forward TCATACTTCGGTTGCATGAAGG
Reverse GTCCGTGGACGTTTACTTCTTT
NT3 Forward AGTTTGCCGGAAGACTCTCTC
Reverse GGGTGCTCTGGTAATTTTCCTTA
GDNF Forward CGCCGGTAAGAGGCTTCTC
Reverse CGTCATCAAACTGGTCAGGATAA
VEGF Forward GCCAGACAGGGTTGCCATAC
Reverse GGAGTGGGATGGATGATGTCAG
IGF1 Forward CTGGACCAGAGACCCTTTGC
Reverse GGACGGGGACTTCTGAGTCTT
EGF Forward AGCATCTCTCGGATTGACCCA
Reverse CCTGTCCCGTTAAGGAAAACTCT
GAPDH Forward AGGTCGGTGTGAACGGATTTG
Reverse GGGGTCGTTGATGGCAACA
β-actin Forward AGAGGGAAATCGTGCGTGAC
Reverse CAATAGTGATGACCTGGCCGT
GFP Forward CTG CTG CCC GAC AAC CA
Reverse GAA CTC CAG CAG GAC GAC CAT GTG