Skip to main content

Table 1 Primer used for qPCR

From: Histone hypo-acetylation of Sox9 mediates nicotine-induced weak cartilage repair by suppressing BMSC chondrogenic differentiation

Gene Forward Primer Reverse Primer Anneal
GAPDH GCAAGTTCAACGGCACAG GCCAGTAGACTCCACGACA 60 °C
Col2A1 GAGTGGAAGAGCGGAGACTACTG CTCCATGTTGCAGAAGACTTTCA 60 °C
Sox9 CCAGCAAGAACAAGCCACAC CTTGCCCAGAGTCTTGCTGA 60 °C
α3-nAChR GGTGGATGACAAGACCAAAGC AGGGCAGGTAGAAGACAAGCA 60 °C
α4-nAChR CACGGTCTTCGTGCTCAATGT CCTTGGTTGCAGATGTCACTC 62 °C
α5-nAChR GCTGCGCTGCTCTTGATGGT CGTATGTCCACGAGCCGAAT 60 °C
α7-nAChR ACAATACTTCGCCAGCACCA GGCATTTTGCCACCATCAGG 60 °C
β2-nAChR GGAGTGGGAAGATTACCGCCTCA AGTCGTCGTGGTTCTCGTTGCG 60 °C
β4-nAChR GATTCTCCCAAGTCAGAACCTTT AAGCTGGAGATTTGATGTGGTTA 60 °C
  1. Abbreviations: PCR polymerase chain reaction, GAPDH glyceraldehyde phosphate dehydrogenase, Col2A1 α1 chain of type II collagen gene, Sox9 SRY-type high mobility group box9, nAChR nicotinic acetylcholine receptor